Online DNA GC Content and Tm Calculator

GC content determines duplex stability: G-C pairs form three hydrogen bonds, A-T only two, so higher GC content raises the melting temperature. Primer design generally aims for a GC% of 40–60%.

Tm (melting temperature) — two empirical formulas are provided here, each suited to a different length range; do not apply them interchangeably:

• Wallace rule, for short oligonucleotides under 14 nt: Tm = 2×(A+T) + 4×(G+C)
• GC empirical formula, for approximately 14–50 nt: Tm = 64.9 + 41×(G + C − 16.4) / N

To be clear: both are empirical estimates that do not account for salt concentration, primer concentration, or nearest-neighbor thermodynamic parameters. For setting a PCR annealing temperature, use the nearest-neighbor Tm calculator or run a gradient PCR. This tool is for rapidly eliminating obviously unsuitable candidate sequences.

Molecular weight is calculated for the single strand, and two values are given: the 5′-phosphate form (sum of residue masses plus one water molecule), and the 5′-OH form (79.98 less than the former, one HPO₃). Primers from synthesis companies ship as 5′-OH by default; the μg-to-nmol conversion on order sheets uses the 5′-OH value. For reconstitution volume after receiving your primer, see the oligo resuspension and dilution calculator.

How much do the two formulas differ: a real example

For the 20 nt primer GCATCGATCGATCGATCGAT with exactly 50% GC:

Wallace rule           60.0 °C
GC empirical formula   51.8 °C

A difference of 8.2 °C. Since annealing temperature is typically set about 5 °C below Tm, that gap is enough to determine whether a PCR yields a clean specific band or a smear of non-specific products.

Why Wallace overestimates

The Wallace rule reflects conditions of high salt with one strand immobilized (approximately 0.9 M salt). In actual PCR, both strands are free in solution and salt concentration is much lower, so the real Tm is roughly 7–8 °C below the Wallace estimate — which accounts for the gap shown above.

The takeaway: Wallace is for quick mental screening, not for setting annealing temperatures.

The right approach for real experiments

For setting PCR conditions, use the nearest-neighbor thermodynamic model (SantaLucia parameter set). It accounts for base-stacking of adjacent pairs, primer concentration, salt concentration, and divalent magnesium — the actual algorithm behind primer-design software and supplier Tm calculators. This site’s nearest-neighbor Tm calculator does exactly that; this tool does not, because the model requires a full set of experimentally measured thermodynamic parameters and its output depends strongly on your actual reaction conditions.

This tool is for rapid screening of obviously unsuitable candidates: GC too high or too low, wrong length, extreme composition. Once candidates are selected, determine annealing temperature with the supplier’s calculator or gradient PCR.

What else to check beyond GC content

• 3′ end: aim for 1–2 G/C among the last 5 bases (GC clamp) to improve binding stability; but three or more consecutive G/C bases increase the risk of mismatch extension.
• Avoid homopolymer runs (e.g. GGGG), which promote secondary structure formation or polymerase slippage.
• Tm mismatch between paired primers should stay within 5 °C; a larger difference means the annealing temperature will be suboptimal for one of them.
• Self-complementarity and primer dimers — check separately with the primer-dimer detector. A primer with acceptable GC% and Tm can still be highly self-complementary, as illustrated on that page.