Bench Tools Free browser-based calculators for the lab and for bioinformatics

ToolsSequence tools

Primer Dimer and Hairpin Structure Detector (with 3′-End Complementarity Analysis)

Detect self-dimers, hairpin structures, and cross-dimers in primer pairs; reports 3′-end consecutive complementarity separately with a pairing diagram.

Detect self-dimers, hairpin structures, and cross-dimers between primer pairs. The seq-stats tool explicitly states when calculating GC content and Tm that “self-complementarity and primer dimers are not checked here” — this page fills that gap.

Why 3′-End Complementarity Is the Most Dangerous

Primer dimers are not a problem simply because complementarity exists — what matters is where the complementarity falls.

DNA polymerase extends from the 3′ end. If the 3′ ends of two primers base-pair with each other, the polymerase will use each primer as a template and extend them, generating a short product — far shorter than the target amplicon but far more efficiently amplified. It rapidly consumes primers and dNTPs. That thick, bright band at the bottom of your gel is usually this.

By contrast, if complementarity occurs at the 5′ end or in the middle, it will not be extended even if more bases are paired, and the harm is much less. This is why the tool reports 3′-end consecutive complementarity as a separate figure — it is more informative than the total complementarity count.

Criteria

These are widely used empirical thresholds, not hard cutoffs:

Metric Recommended Rationale
3′-end consecutive complementarity ≤ 3 Above this, extension into a dimer product becomes likely
Longest consecutive complementarity (any position) ≤ 4–5 Long complementary runs stabilize binding and reduce effective primer concentration
Hairpin stem length ≤ 3–4 A long stem causes the primer to fold on itself and fail to anneal to the template

A Cautionary Example

GCATCGATCGATCGATCGAT looks unremarkable, yet it is an extremely poor primer: it consists of repeats of ATCGAT, which is a palindrome (the ClaI restriction site), so the full sequence is highly self-complementary — 18 complementary bases in the self-dimer, 18 consecutive complementary bases at the 3′ end.

This is completely invisible when you only check GC content and Tm. That sequence has exactly 50% GC and is 20 nt long — it passes conventional screening criteria as “acceptable.” This is exactly why dimer analysis must be done separately.

Scope of This Tool

This tool counts complementary bases; it does not calculate thermodynamic ΔG. Professional primer design software (Primer3, IDT OligoAnalyzer, etc.) computes nearest-neighbor free energy, incorporating temperature, salt concentration, and primer concentration — substantially more accurate than simply counting bases. (Primer–template Tm and ΔG can be calculated with this site’s Nearest-Neighbor Tm Calculator; however, ΔG for self-folding structures such as dimers and hairpins requires a separate secondary-structure algorithm — the two are not interchangeable.)

This tool is intended for rapid elimination of obvious problem candidates — cases such as a run of complementary bases at the 3′ end that are immediately identifiable. Once the candidate list is reduced to a few sequences, use professional software to calculate ΔG for a final decision.

This tool also does not perform template-specificity checking. Whether a primer has additional binding sites in the genome requires BLAST or Primer-BLAST alignment, which cannot be done in a browser.

FAQ

Why is 3′-end complementarity emphasized so strongly?

Because DNA polymerase extends from the 3′ end. If the 3′ ends of two primers base-pair with each other, the polymerase uses each as a template and extends them, generating a short product — far shorter than the target amplicon but amplified far more efficiently, rapidly consuming primers and dNTPs. Complementarity at the 5′ end or in the middle is not extended and is much less harmful.

What is that thick, bright band at the bottom of the gel?

Almost certainly a primer dimer. Its length is typically 40–100 bp, well below the target band. This band means the primers are amplifying each other, noticeably reducing the yield of your target product. Start by checking 3′-end complementarity with this tool, then consider raising the annealing temperature or redesigning the primers.

GC content and Tm are both within spec — why isn't the primer working?

Because neither metric detects dimers. The cautionary example in the introduction is exactly this case: GCATCGATCGATCGATCGAT has exactly 50% GC and is 20 nt long — it passes conventional criteria as "acceptable," but it is built from repeats of the palindrome ATCGAT and is highly self-complementary, making it an extremely poor primer.

How is this different from Primer3 or IDT OligoAnalyzer?

Those tools calculate nearest-neighbor thermodynamic free energy (ΔG), incorporating temperature, salt concentration, and primer concentration — substantially more accurate. This tool counts complementary bases and acts as a rapid filter: use it to eliminate obvious problems from a large candidate list, then run the remaining few through professional software for a ΔG-based final decision. The two approaches complement rather than replace each other.

Why doesn't the tool check primer specificity against the genome?

That requires aligning the primer against an entire genome — gigabytes of data — which cannot be done in a browser, and this site is committed to keeping your data on your own computer. Use NCBI Primer-BLAST or local BLAST for that step.

Related tools

Nearest-Neighbor Primer Tm Calculator

Calculate primer Tm by nearest-neighbor thermodynamics, returning ΔH°, ΔS°, ΔG°₃₇, with Mg²⁺ and dNTP converted to Na⁺ equivalent.

DNA / RNA Reverse Complement Online Converter

Paste a sequence to get its reverse complement, complement, or reverse; supports FASTA input and IUPAC degenerate bases.

Online DNA GC Content and Tm Calculator

Calculate GC%, base composition, molecular weight, and two empirical Tm values — for rapid primer screening.

No ads, no tracking, no sign-up — and every formula here is checked against a known answer. Keeping it that way takes ongoing work. If it saved you time, buy me a coffee.
Buy me a coffee